Insertion MI13749

Gene Information

Affected Gene(s)Comments
CG14528     CG33203     There is a copy of TE mdg3 located about 300 bp from the 5' in of the MiMIC insertion

PositionCG33203 - coding intronCG14523 - 3' downstreamCG14528 - 3' UTR exon
PhaseCG33203-RD:1, CG33203-RE:1, CG33203-RF:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R28877708-98F13R:28877708

FlyBase AnnotationTransposon
FBti0166404Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 59193

Flanking Sequence

MI13749-3'
(KO454081)
TATATAGGGCTTTATCAGTAGATGGCGCACTTGTACTCCGGATC
MI13749-5'
(KO454082)
GATCTGTCCTTTAGCTTGGTTCAACAGCGACTGACTGCCGCGCTCTCTGC
AGAGTGGCGAGTCGATTAGTCGATAAGTTTCTCGATAATATTTGTATGTT
AAGGATGGGTGTATGAGTGTATAAGCTTATGACTAGATTGGCTATGTATA
ATTAGGTATGTATGACTAAGAGTAAAGGAAGAGGGTAGAAGGAGCAGCCT
ACTACAAATGGTTACTTCTCGACAATTTAATATACACATATATATTGTCA
ACAGCAATTATCAGAACGTATATATAGCCATGACCGCCGTGTCTATATGT
TTCTACACACTCTCATTGATAAAGCTACTTTGTTTACATTTCTATACACA
TTAAGCATTTATTATATATAAATGCCAGAACTACATTTATGCCAATTGAA
AGATGCTATTATATTTGTTTGTTTATTTTTCATTCATTCATTTGAGCTTA
CCAAGTTAGGCAACATCAAAGCAAAATTAGTTAATTAAAAAATGAATGAA
CTA


Search Again