Insertion MI12433

Gene Information

Affected Gene(s)
oaf          

Positionoaf - coding intron
Phaseoaf-RA:1, oaf-RB:1, oaf-RC:1, oaf-RD:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L2496058+22F42L:2496058

FlyBase AnnotationTransposon
FBti0162528Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 57942

Flanking Sequence

MI12433-3'
(KG961365)
TACCTATAAAAAGTCATCGCGTGCGCTGCGCAATATGGTTGAAGTTTTGC
ACAAACAAAATTATTAAAACGAATCTATAAAAGCAGTACGTGCATATATA
CAATGAGGAAAAAGTTAAAGCATTCATTTCCAGTTTTGCCTTTTAAAGAG
TTACCAATTATTAAAACAAAAACATGTTAATCGAAAGTTAGGAAAGTTAG
TTAGAGAAATCCGTCTGAAATCTTGGTAGATGGAAAACTTCAGTACAGAT
ATCGACCAGTTTTGAGGGTTCTTGCCACTTTCAAACTTTTTGTTTACGCT
TTTGTTTCGCTTTCCGTTCGTTGTACTCCTGCTCCTGGCAGGCTCCTCGA
TTTCCAGCCTGGAGGCCGCCACCGAAAAGTTCCCGGACACGCTCTCGACG
CGCTGCAACGAGGTGAGCAGCCTGTGGGCGCCCTGCCTGTGCAACCTGGA
GACCTGCATCGGCTGGTATCCCTGCGGGCTCAAGTACTGCAAGGGCAAGG
GAGTCGCCGGAGCGGACTCGTCGGGCGCCCAGCAGCAGGCACAGCCGACG
AATTATCGCTGCGGCATCAAGACCTGCCGCAAGTGCACACAGTTCACCTA
TTATGTGCGGCAGAAACAACAGTGCCTCTGGGATGAATGACGACGCGGCG
AGCTGCAGCTGATGCAGATGCGCTGCGCGAGGCGGC
MI12433-5'
(KG961366)
GATCCAGGAGAGTATTACCTCCAACATTGGCGAGGACCTGATAACGCTGG
AGTTTCAGAAGACCGACGGAACGCTCATCACCCAGGTCATCGACTTTCGC
AATGTGAGTGAAGAATCCGAGGCTCTGGAGAGCAAGGCGAGAGACCCAAT
TGAAATTGAAAAACTCTTATCCATCTTCCCTGCAGGAGGTTCAAATCCTC
AAGGCTCTGGTTCTCGGCGAGGAGGAGCGTGGTCAGAGCCAGTACCAGGT
CATGTGCTTCGCAACCAAGTTCAACAAAGGCGACTTCATCTCCTCGGCGG
CAATGGCCAAGCTGCGCCAGAAGAATCCGCACACCATCCGCACTCCCGAG
GAGGACAAGGGCCGTGAGACCTTCACCATGAGCAGCTGGGTACAGCTCAA
CCGCTCGCTGCCCATCACCAGACATCTGCAGGGACTCTGCGCCGAGGCCA
TGGACGCCACCTATGTCCGGGATGTGGACCTTAAAGCTTGGGCGGAGCTA
CCAGGTGAGTGCTTCCCTGGGGATGTTCAGTGCGTGAAATTGGTAAATCT
TTAAATGGAATATCCCTATAAGTAATTTTAAAGCACATTTATGGTTGAAT
GTTTTTCTTTTTAATTGTTTTCAATTTTTTGGATAATATTAAAACCGTTT
GCGCTGCTGATTATTTAAAGTTCTA


Search Again