Insertion MI11538

Gene Information

Affected Gene(s)
drk          

Positiondrk - coding intron
Phasedrk-RA:2, drk-RB:2, drk-RC:2, drk-RD:2, drk-RF:2

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2R13497735-50A132R:13497735

FlyBase AnnotationTransposon
FBti0162182Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 56333

Flanking Sequence

MI11538-3'
(KG779838)
TAGCTGGTATTACGGACGCATCACACGCGCCGATGCTGAGAAGCTGCTGT
CAAATAAGCACGAAGGCGCCTTCTTGATACGCATCAGCGAATCCAGTCCC
GGCGATTTCTCCTTATCAGTCAAGTGAGTTGCGCTTGAATGGCTTCAGCT
TTCATATTTATGATTGAAAACCGTATATAATCGAAATTCTTTGCCCCTTC
AGATGCCCCGATGGCGTTCAGCATTTCAAGGTTCTGCGCGATGCCCAAAG
CAAATTCTTCCTCTGGGTGGTCAAGTTCAACTCCCTCAACGAACTGGTCG
AATATCATCGGACGGCGAGCGTGTCCCGGTCGCAGGATGTCAAATTGCGT
GATATGATACCTGAAGAGGTGGGTGTGCCGTCCATTCCATTCCATTTTGA
TGTGATGAGTTTGCTCAGCAAACATGCAGATTCATTTTAAAAATACAAAT
TTCGCATAACACATTGAGGTCATGTTTGCGTACGATGCCGCCGCCACCGC
CCACCCATTTGAACTATAAACAAACAGCGATGCCAAGAGTATTAGATTGG
ATTCATTATGTCCGAACGATTTTTTTTATTGCAGATGCTCGTGCAGGCGC
TGTACGATTTTGTGCCACAGGAATCCGGGGAATTGGACTTCAGACGCGGC
GATGTCATCACCGTCACAGATC
MI11538-5'
(KG779839)
GATCATTTCTATTGTA


Search Again