Insertion MI10307

Gene Information

Affected Gene(s)
Mdr49          

PositionMdr49 - 5' UTR exon
PhaseNone

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2R12945194+49E32R:12945194

FlyBase AnnotationTransposon
FBti0158863Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 54524

Flanking Sequence

MI10307-3'
(KG772186)
TATGAGGCGATACTGCAGTAAAGTATCTCTATACTCGCTATAGCAATTAA
GCCTAAGAACAAAGTTAACAATTAGTAAACACAACATTTTGTGTGCTGGC
CTGATATCTAAGCTCTAAATTGGGGTCTATAATTTAGAGTGTATCAATTA
AAGAACTTAACCACGAGAACCACAAACACACCCAGTTGCTCTCGCTTTTT
ATCTGCAAACTCGACTATAAAAGCCTAATTACTATCTTCTTAATTCTAAT
TCACAAAAAGAGTTCAGTGCTCTTAAGGCAAACATGTTATCCCAGGAAAG
TTACTGGGGAGATTAACAAAAGTATGATTGAATTTTAAAAAATATTTCAA
CTCTTCAAAGAATTCAGGCTCAGATTTAACATAATGTTATGAAATAAATT
TCTAGAACTTTATCTTCTTGCATTGCCACTATTTTATAATAATAGTTTGA
CATTCGTTTTTTCTTAACAAGAAATACTTGCACTTTTCTTGCACTTAATT
AAATGGAAATCAATGTATCTCAACATCTTGGAAACACGTAATTATAATAC
CATTAAAATAACTAATGTTGATAAAAATGGTAGCAATTATGACGCTTAAG
TGTGTGATAATTAATGTATCTTTACGTGTTACATAAAATATATTGTAGAA
ATTATTCGACGCAGAGCAAAGGGCTGATTAATCAGCAAAAACAATTTTCC
CAAGTCAATTTAAGGAAATTAGCTCGATTGCGCGAATGAAAAACAAGCGT
ACATAAATTAATAAATTAAGCGCAATTGGAAAGCGAGATATTTGTGTGTT
GATTGCGATTGTCAATTGCGAACGGCTTGC
MI10307-5'
(KG772187)
GATCCTTCCTTAAGCTGAAAGTCACCAGCTTGTGGCAGCCGTGATTCCTC
CTTCTTGACCATTGTGTCTA


Search Again