Insertion MI10235

Gene Information

Affected Gene(s)
CG3714          

PositionCG3714 - coding intron
PhaseCG3714-RA:1, CG3714-RB:1, CG3714-RC:1, CG3714-RD:1, CG3714-RE:1, CG3714-RF:1, CG3714-RG:1, CG3714-RH:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L4194539+24D82L:4194539

FlyBase AnnotationTransposon
FBti0156707Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 53235

Flanking Sequence

MI10235-3'
(KG702195)
TAGTTCATATATAACATCTAAGAATTTGTAGATC
MI10235-5'
(KG702196)
GATCAATGCCTTAGATATGCTGGCCTATGGACTACTTAAATGCCCTGTAA
ACTTATTATGGATAATTACTTAAGCGCTGACAAACAAAATGTTCGTTTAG
GCTCGTATTTGTGATTAAAAGTATATA


Search Again