Insertion MI10220

Gene Information

Affected Gene(s)
unknown

PositionCG17572 - 3' downstream
PhaseNone

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L19070799+37B132L:19070799

FlyBase AnnotationTransposon
FBti0156804Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 53471

Flanking Sequence

MI10220-3'
(KG771907)
TATTCAATGCTATAATCACAATCTGTTTTAGTTGAATATGGCCAACATCT
ATCTCAAACAATATCAAATAAATACATTCATTTTAAAAAAAGAAAAGATT
GTAGAGTGGGGTTCCAATTGTCCACATGTTTTACTTCCCTATCGTCATCT
TATTTGTATAAAAGATC
MI10220-5'
(KG771908)
GATCCCAGTGGCTCATAAAAACAGCTGACTCCAATTAGCCACATGGCACC
GGTACCGGCATCCTCATCGGCATCTCGGACTCTTCTCTCCGCACGCACAT
GGTCAACTCAAAGCCCATGCAGGAGAATTCCCATGCAGACTTTGGAGCGA
TTAAGTTTAACGAGCCGGCAATGAGGAGTTTTCGGTTTCGGAGAGCATAG
AACGTGCATAAAAAAAGAAGGTGGAGCTCTGACACAAAACAGGGAATATG
GCTAAAGTGAATTCTAAATAAAAGTTACTGGAGAATTGGCTAAGATATAT
GAAGTATCGATTCTGAAGTATATGCTTCAAAATATTATTATGCCACATTA
ATTCATATGCATTTTTTCTCTTGTGTACTGTGCTTGAAATCAGTGGTTCA
CCTTGATTAACTCATTTGATGGAACCACTTAATTGAAAAATGTCTTCCCT
TTTAAATGTGCTCTAATAAAAGGAATAAATAAAAATTGCTGGAATAAATA
AGAATCATCATGTGAGTTTTTTATCATGGGTAAGTTTATATCAAGTTTTA
TTCATTAATTGTTCAAATA


Search Again