Insertion MI09190

Gene Information

Affected Gene(s)
CCHa1          

PositionCCHa1 - coding exon
PhaseNone

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R14093143-88A83R:14093143

FlyBase AnnotationTransposon
FBti0153241Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 51261

Flanking Sequence

MI09190-3'
(KG699455)
TAAACAGGTAAGATTGAGAATGACCTTTGAGTATAGAAGGAATTAATTAG
TTTAAATTTTACTACTGCCTTCATTTTAAAATTTAATTTGTTTTACCTTT
TAACAGCATCCCTTGCCAAATTCATATGGCTTGGATAGCGTGGTGGAGCA
ACTGTACAACAACAACAACAACAACCAGAACAACCAGGACGACGACAACA
ACGATGACGACAGCAACAGAAATACGAATGCGAATAGTGCCAACAACATA
CCCCTGGCTGCTCCAGCCATTATAAGTCGTCGAGAATCGGAGGATC
MI09190-5'
(KG699456)
GAACTTGGGGGCAGAAGATTAGGCAGCGAGCAAGCGTTTGTAATATTTTT
GGCAACATTTATGTAATAATAAAATGTTCTGGAGGCTACTTTAAATAAAA
AATGTTTGAGAAAGTTTTTAAAAGGTAATCTACGTATGATATTTGGTTTT
TAAATAGGAATTCTATTGTTGTCTCCAGTGGTATATTTCCCCACAGTGCT
GTTGAATTATCAAATTGCTAGGATGCAGGACTGCAACACCTTGATGTGCC
CACGCCGAGTGCATTACTCAACCCACTCCGACTTGGCATATGAGTTCCAT
AATGGTCGCATTTATCATGGGTCGCGACATTAGCAGCCAAGCACACACAA
TAAACATGTGCTTTTTACACGGAAAGTAGCAGCCGAAGTAGCAGCATCAA
CGGGATGCTGGTGAAAGTAGCTTTTACTATAGAACCGTAAAAAAAGAAGA
GAAAGTTTTAAAGCCCAAGCTTAGGCTCGCTGTGTGGTCGAAGCTACGCT
GCTGTGCTGTGTAGGTTTTCTGACACCTGGCTGCGTTTCTAGCAAATTTA
CTTGCGCACAAAGTCTTAGAGCTGCGGCAAACTGATGATGATTTATACTA
AATTGGAAAAAATGTTGCATACTTTCAGGTTCCTGCCTGGAATACGGACA
TTCGTGTTGGGGAGGTAAGTGGCTCGCCGGTTAAGCTCTGACGGGAGCAG
TTCATCATCACAACTGGCCCAGGAGTCGTGACTCATGTTTATGTATTCCA
CAGCTCATGGCAAGCGGTCCGGCGGGAAGGCGGTCATAGATGCTA


Search Again