Insertion MI06534

Gene Information

Affected Gene(s)
unknown

PositionCG17572 - 3' downstream
PhaseNone

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L19071122+37B132L:19071122

FlyBase AnnotationTransposon
FBti0156532Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 53061

Flanking Sequence

MI06534-3'
(KG701864)
TAGTCCGCTGTTGGTATTTATTCATATCTTTATTTAAATAATGCAATTTT
AGGTTCTACTTAAGTGGAGTCTACTCCGGCGGCGTGTTGTCGTGAATCCA
CTCGGAAAAGTGGGCCACGGATGTGTAGACACTCGGGATGCGCAGACCGC
CGCAGTTATCAGATC
MI06534-5'
(KG701865)
GATCAATGGGCAGCGCCACAGAACGCAGTAGCTTTCTACGATAGCTTTGA
ATAATGAATATA


Search Again