Insertion MI06465

Gene Information

Affected Gene(s)
unknown

PositionCG31743 CG34313 CG6115 - 3' downstream
PhaseNone

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L16886641-36B32L:16886641

FlyBase AnnotationTransposon
FBti0156529Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 53058

Flanking Sequence

MI06465-3'
(KG701858)
TATTCGAGCTGATTGAGCTTTTCGTTTCGCGCTGACGAAAACATGAAAGC
TTTTCTGCAATGCAACTAAAGATC
MI06465-5'
(KG701859)
GATCGCAGGTCGCCCCAGTACGAGTATACCTATAAATATATACACGCTGA
CCATTTAACCGTCCATGTTTTGGTGATAAACAATCGCCGACGTA


Search Again