Insertion MI06446

Gene Information

Affected Gene(s)
prominin-like          

Positionprominin-like - coding intron
Phaseprominin-like-RA:1, prominin-like-RB:1, prominin-like-RC:1, prominin-like-RD:1, prominin-like-RE:1, prominin-like-RF:1, prominin-like-RG:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3L3120625+63B33L:3120625

FlyBase AnnotationTransposon
FBti0148267Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 40809

Flanking Sequence

MI06446-3'
(JY085217)
TAAGTGTTTTATCCTTTATTTATCCAATGTGTACGTCACTCACCCTCCGG
AATGGGTTCATCCCTATAAAGAACCTTGTCATATAGAAAGTGTGTAAAAT
TGAAAATGGGGTTCATGGCGGACGTGGGAGGTGGTGGTGCCTTTGTGTAG
TTGGTTGTCGGCCGGTATACAGTGTACTGGACTGGTGGCCAATGGGGCTG
GCCAAGCTGTTCGTGAGTGGTGCCATGGCCCACATATCCCTTGCGCCAGC
TCCCGGGATC
MI06446-5'
(JY085218)
GATCCCGCCAGTCATTCTCCTCCACTTTGGGACCCAAGCTCAAAGTGTCC
GAATTCTTTACGACAATGTAACCTGCAATATTAAGAGAAATA


Search Again