Insertion MI06071

Gene Information

Affected Gene(s)
CG32676          

PositionCG32676 - coding intron
PhaseCG32676-RA:2, CG32676-RB:2

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
X10727033+9E1X:10727033

FlyBase AnnotationTransposon
FBti0148761Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 41509

Flanking Sequence

MI06071-3'
(JY127570)
TAGTAATCATGTTCATTAGAAGGGTGCTGCCAATATTATCATTAAATCAA
TAAACGGTTTTCTTGGCATATACAAAGATC
MI06071-5'
(JY127571)
GATCTTTGAGCGTGCCATCCTGCAGTTTTTTGCAAAAAAAAAAAGAAAAT
AAGAATA


Search Again