Insertion MI04913

Gene Information

Affected Gene(s)
Nhe2          

PositionNhe2 - coding intronNhe2 - 3' downstreamNhe2 - 3' UTR intron
PhaseNhe2-RA:2, Nhe2-RB:2, Nhe2-RC:2, Nhe2-RE:2, Nhe2-RG:2, Nhe2-RJ:2, Nhe2-RL:2

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L21131995-39A32L:21131995

FlyBase AnnotationTransposon
FBti0146963Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 37911

Flanking Sequence

MI04913-3'
(JS799479)
TAGGTGGTTGGTGGTTGGTTATCGATGGTGAGGTGATGTGAAGAGAAGGC
GTAGAAAGTTAATGTCAGTTGTCAGTTGTGATC
MI04913-5'
(JS799480)
GATCCCGGTCTTCTGCCCGTGGCCGGTGTTGTAAAGGTGGTGACCACAAT
GTTCTCGTCATCGTAGGAATCGAAGTCCTCGTCCTCATCATCATCGTTCT
CATCGGAGTCGGTTTCGGAATCCTCGTAGTCCAACAGTGCCTTGGTCACC
TGGTTCTTACGGCCCGCCTGGCTCACGCCTGCACCGCCCACCGCCCCGGC
GTTCATGCGCCGAATCTGGGCACGAGGCGTGTTGGATGGGCGTGGCAGGA
GTGGTTCCCTGCCGCTCATTCGCATCAAAAGCTCGCTGTTTGCTCCGCCG
GCTGCGGACAACGGTGCTCCCTCCCATTCATCGGAGTCCGCCGGCTCGCA
CAAGGACTTGGAGTGTCCGTGCTGGTACGACGACTCCTCCGGTATTGTGT
CTCTGTTGGTGGTGGTGTCGTGTGGAGTGTGCGGTGGTTGTA


Search Again