Insertion MI04004

Gene Information

Affected Gene(s)
CG17646          

PositionCG17646 - coding intron
PhaseCG17646-RA:0, CG17646-RB:0

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L1743613+22B22L:1743613

FlyBase AnnotationTransposon
FBti0150089Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 42302

Flanking Sequence

MI04004-3'
(JY137502)
TACTTCTGCACTCCTTCCCAGATC


Search Again