Insertion MI03811

Gene Information

Affected Gene(s)
grim          

Positiongrim - coding exon
PhaseNone

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3L18304048-75C43L:18304048

FlyBase AnnotationTransposon
FBti0145278Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 36978

Flanking Sequence

MI03811-3'
(JM496876)
TATCAGCAAAACGGCCAGCAGACAGCAGCGAGTCCAAGGACAACTGCAAC
AGCTGCTGCACCATCGCAGCAGCAGCAACAATCGCAACAACAGCAGCAGC
AGCAACAACATCATCATCAGCAACAGCGCCCACAATTCCGTGCCAATATT
TCCGTGCCGCTGGGAAGTCAACAGGGATC


Search Again