Insertion MI03594

Gene Information

Affected Gene(s)
dpr9          

Positiondpr9 - coding intron
Phasedpr9-RA:1, dpr9-RB:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R15062973-88E13R:15062973

FlyBase AnnotationTransposon
FBti0146194Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 37603

Flanking Sequence

MI03594-3'
(JM973143)
TATAAAAACTCCCACCATTCTTTGTTCAAATTAAATCCGGAAATGTTTCC
TGCTGCCAGTACTTTGTACGATTTTTCTTATTGCACAAAATATATTACGC
GAGTGTTTGAGAAACTTTTGTTTCCTTATGAAATCAACACTTTAGCTTTA
ACTCTTGCGCATTCAAGTTTACTGGAAACTTAAACTCGCTTTCTCTATAG
AAACCCACCTACGAAAAGTGTCGCTTTCATCCTTTCGAGAGGTTGAAGTT
GGCGCGTTAAATTCTGATTGAATTAAATAACAAAAGAGTGTAGTATAATG
GAAAAATATTTTCATCTCACTCTTCGCGCCCTCCAATTGCGTCTCTTGAA
AAGGATGAACATGTTTCTCCTTTCACTTCGCTACTGAAATATCCCAGATG
AAAATTTTGCTCTTAGCTAATTGATATTTTATTCCAGTTTGATTCACAAA
ACAATTTTCTGCACTTCACCTTTTTAATTGCCTTTTCCTTTTCAGAACCC
TCGACGGAAATCATCGGTGCACCCGATC
MI03594-5'
(JM973144)
GATCAGCGCTTTCGGGCCATTCATCAGCCGCAAACTGAAGACTGGATGCT
GCAAATCAAGTACCCGCAACATCGAGATTCCGGCATCTACGAGTGCCAGG
TATCGACTACACCCCACATGAGTCACTACATTCACCTGAATGTCGTTGGT
AAGTTGGAAAAATCAAAAGATAATGATACTTCATGAAAGCGCTTTAAATG
CTGACATGCTCTATGAATACATTGTTTAAACTTTTTACTTAACTCGTTCA
GAAATACAATACCTATAGCGATATACTTAAAACTTCTGAAATAGTA


Search Again