Insertion MI03375

Gene Information

Affected Gene(s)
Frl          

PositionFrl - coding intron
PhaseFrl-RA:0, Frl-RB:0, Frl-RC:0, Frl-RD:0

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3L14064369+70D13L:14064369

FlyBase AnnotationTransposon
FBti0146190Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 37600

Flanking Sequence

MI03375-3'
(JM973135)
TACCACGCTTCATGCTTAAAAATGTTTAGAGTTAGGCAAGCCATCGATGC
TTATGTGTTTTGGGGGATC
MI03375-5'
(JM973136)
AAAAAAAAAAAAGAAAAAAACAACAAACAACAGGCCAAAACAAGTATA


Search Again