Insertion MI02796

Gene Information

Affected Gene(s)
CG15630          

PositionCG15630 - coding intron
PhaseCG15630-RA:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L4769359-25A42L:4769359

FlyBase AnnotationTransposon
FBti0143175Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 36253

Flanking Sequence

MI02796
(JM113849)
CATATTTATGTGTTTTTTTTTTTAAATCATCAAATTCCTCGGTAACGCCC
TTTTAACAATGGCAGAAATTCTCCTAGTTGCAAGCCATTTTTTCATCCAA
CTCGTTGACCATCCCAAGCATTTTCATTGCCATTGAGAGGTGGAGTTTTG
CATTGGTTTGCTTGCCCGACTGTTTTCCGAGCAATTAATTTCATTATTTT
TCATCTGGCTGCATAATTTTCATGAATGGCAAATCGAGTCGCTCGACGAG
CTATCAGCGGGATTTTCTCGCTTTTGAGCAGCGCTAGAATGAATGAAAAT
GAAGGAAAAACTCCGCGCCGCATGCTGTGCAAATCGTTAGCGCTGATTTA
TTATTTATTGCTTTGGTTTTGGTCCCTGATTTATTCTCGGCTGATAGAGG
GAAAAGCTGGCTGGAATGGGTTGGCTTAAATGCCTTGCGCTTTTGTTTCG
TCATTCCTGAAATTTTCTTTGTTTCTCTTTTTTAAATGTTGCACTATCGG
AACATTCAATCGGGTCATGCAATTAAATGATTTATCACATAATTTATTGT
TCTGCTGCGGGAGTTGAGCCCCGGGGAAAAATCGTCGCCCATGTATGAAA
TATTGAAAAAATTCCAGATATATTTTATGTATTCAAATTGAGACAATAAT
TACGATTGAATAACTATGTATTTTTAATAACTGATC


Search Again