Insertion MI02136

Gene Information

Affected Gene(s)
ry          

Positionry - coding intron
Phasery-RA:0

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R13036352-87D93R:13036352

FlyBase AnnotationTransposon
FBti0131798Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 33165

Flanking Sequence

MI02136
(HR505022)
GATCATTTTTAAGAATTTTTAGATTATTATTTATAATTGTTTATGTCAAT
ATAATCCTGGTGCTTGCTTTCCTGATTTGACTTAAACATTCTTAAAAGTT
TCAAACTATTTGCACTCAGGATGATAACATATATGGTCCTAGAAATTCCC
ACACTAACCAGATGTTCCATGGAAAATACAACACATGGATATTTGAGCAA
ACATGGTATGCATAAAGAAACCTACATATGGATTTTCCATAAACCCACCA
CTCTTACCGAAAATGACAGATC


Search Again