Insertion MI01833

Gene Information

Affected Gene(s)Comments
5SrRNA          Insertion is within the transcription unit of a copy of the 5SrRNA repeated gene family

Position
PhaseNone

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2R19729674-56E22R:19729674

FlyBase AnnotationTransposon
FBti0131564Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 32789

Flanking Sequence

MI01833
(HR235322)
GATCACCGAAATTAAGCAGCGTCGGGCGCGGTTAGTACTTAGATGGGGGA
CCGCTTGGGAACACCGCGTGTTGTTGGCCTCGTCCACAACTTTTTGCTGC
CTGCTGCCTGCTGTCTGCTGCCTGCTGCCTTCTTAGTTTTTATTTTAGCA
TTATTGGCTACAAATCAGAATGAAAACTTTGTTCACCTAATTTCAAATTT
TGTCTTTCACTCATTATTAATCTTTTATATCTTTATTACGATATCTAAAA
CCCAATGGTACAAAAACAGTCTATTTCAGTCTATGGGCATAACTGAATAT
CAGAGTATAAGGACACTGTTTAGCCCCTCGACTTTCGCCAACGACCATAC
CACGCTGAATACATCGGTTCTCGTCCGATC


Search Again