Insertion MI01455

Gene Information

Affected Gene(s)
CG2781          

PositionCG2781 - coding intron
PhaseCG2781-RA:0

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R7987489+84E63R:7987489

FlyBase AnnotationTransposon
FBti0140004Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 34435

Flanking Sequence

MI01455
(HR808515)
GATCGGGGTCGTACCTGGGCTGGGCTCTATTAACCAGGTCACAAAGTCCG
GAAGAGACAGCATCGCATCCCAACAATGTCGCCGTTGATTGCATCTAATT
AAGATTCACTTTCCGACAGAGACTCTGTCCAAGATTTTCACTTTTTTAGG
TGCGTGCTAGTTAATTGAATTTTTAGGCAGTAGGGGGAAACTTGAAAGTA
CAAAGAGCAGTCTTTGAATACTCTAACGGGATAGGGAAAATTACGAAAAC
ATAAGCGGTGATAACTCGCAACAAATTACATCATATAAGCCCCATAATTC
ATGTTCCTCGAAACTCCCATAAATTATTAAAAAAAAGTCTGATGTGCCAC
TTGGCAAATTGCTGAGCTTGAACTATTGAATAGCACAGTTGTGATAGTCA
AAAGTGTTTACCCATCTAAATTTTCATATTTTATGTCTCATCTTTCTCTT
ATCAATGATATAATAGAATTTTTTCGAATTTATAGGGACTATATGGTAAT
CTACGACCTTGCAAGAGCTTGTCCTCTTCCGGTGGGGAAACTTTTTCGAA
GTATTTCGCAGCTTTTTGGAATGTTGAAATCACACCTGGTGTGGGTGTGT
GTAAATCAAGTGTAAATTTGACCAATTAAAGGCACTATTATACCAAACAC
CGACAGTACTTATTAAGCTATTTGCATTGAGCTCTTCCTGGCCAACTGAC
GTAGGTCAGCAGCAGCTGCTTTAATTTCACATATTTTATGCCATTTGATT
AAGGAAAATTACTAGCGATGAGCGTCATAAAACCCGTTTTCACACACTAT
CTGGGTGAGATC


Search Again