Insertion MI00496

Gene Information

Affected Gene(s)
Cdep          

PositionCdep - coding intron
PhaseCdep-RE:2, Cdep-RF:2

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R4944973-82E33R:4944973

FlyBase AnnotationTransposon
FBti0129409Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 31030

Flanking Sequence

MI00496
(GS926641)
TGAAGATGGATTGACCATCAATAGAGCATATTACATAGAGTTATTAGACC
GTTTGAAGGTCGAAACCGCCCGTGTCACAAGTTAGTGAAAACGATGGAAA
AAATCCATGAAATGGGCTTCAAATTTCTTCTGATTTTTTCCGAATTTCTT
ACTATGGTAGGCCGACGACTTAGTTGTTTTCTTGTGTATTAATTTTTGAT
ATTTATTAAATGTAATGACTTAAGCTTATGATTATAAATTTTATAATTTA
TGTTAGAAAATACAATTTCAATTACACATGCCTTTTATAATATTTTTATT
TGATTTTGGAATCAAGTTTATTTTATACATTTCTTCCACAATAAAACTCA
AAAAAAATGGATAGGACTGCTTTGGAAATCTAAAACACTTAAAGCCAGCT
AATTGGTACACTTGCAGGAAAATATAAAATATTTCCCAAAGAAACAAAGA
CGAACACACCGACAAAGTCATTATATACAAATTCACTATAAACCGGCCAT
AATAGGACATAGAAAACATCAAGAAAGTAATGTTGGAGATAAAGTAAACA
TACATAAAATGGAAATATTGGTTGTGTCGTATACGGTGTGTAAAAATAGA
ATACTAAAAGGCGTGGCTATGCGTTTGATTTTTGAGTGCCTCCATTATGG
AATTGCACAAATATGTGGGACCAACGCGTCTATCCTGGAAACACTGAGTT
CTTTTAGTTGCCCAACACAGCATGGCTGTGTACGTTCTTGAAGTCCTGGG
TTTGGGTTGTGCTGCGCAGTACCTCCAGCCATCTATGAAAACAAAATTGA
AAGTTTTTAAATACATTTAAAGGTAAGCCAAGGGTTACTCAGGTGGTGGG
AGCAATTTTTAGGACAAATATTAAAATGAAAAAAATCAACAAATTTATTA
AAATTATGCGCGTGACAGTTTATAGAGTTTTGTCGGCGTGGAGTACTTCT
GAAACAAAATTGCTTTACATAGGCGTCTCTAGTTTGTGCGTAGTAAGAAT
TTAAGTATACGTACATTATCTTAGCGTTCATACACATACAGTGACGCTCA
ACTGAATAGGTTTGACTATTTGTTTAGGATTGAAACGTTGTAACTTAGTT
ATATGCAATCCGATTTAAGCGAAATAAATTTGTATGTATGAATAGATC


Search Again