Insertion MI00438

Gene Information

Affected Gene(s)
jumu          

Positionjumu - coding intron
Phasejumu-RA:0

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R10353312-86B13R:10353312

FlyBase AnnotationTransposon
FBti0129381Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 31002

Flanking Sequence

MI00438
(GS926609)
CATAACACTAGGTGCACAAAAATATATCAATCTATGGGAATATACGATTT
GTGCATTTTAGAAGCTATTTGCATTATCGGTAGACCACTGTAGCTTCCTA
TTCTTCTTCCTGCAGTAAGCTGCAATTCCAGAACCAGAATCGTAAACAGT
TTAGAATTGCATCCGCGCCAACGGAAAGCTAACTTCCTGGCTCTAATTAG
TTTACAGCCAAGGAATTGCCACTTTCCGCACCTTTTTCAAATGGGGGAAA
ACGAGGACAGTGTGCGGGTGAAGGGTTAATAAATCCCTCAGCACGAGAGA
CGTAATAAATCAACCGGCTTTCGAATGCGGCGTTCAGAAACACGAGGAAA
AGGCCTAGGTAGTCAGTTTGAAAAGCCTGCCCACCTTCCTTTGCCCCCAC
ACCTCAACTTTATTTTGTATTTTTTTTCTTTTCCCCATTTTTCTGCCCCC
CCAAAAAATTCTCGAAAAAATGTGCCGAAATAAAAATGCATCAAACAGGC
GAGCAAAGTTCACAGCAAGCTGCTTTTGGTTATCGGGGGGATTAAAGGAA
AATGCAAAAGTTGTCAGTAAAACTTCGACGAGGCTTACAGACACCGCCAC
CACTCCCGTATTTCAGCACCCCCTCCCATACAACCCACCGTAGGCCATAA
AAAGTTTTTGCTGCTCTGTTGCAGCTGCCTACAGTTGGCCTTTTCAAGTT
GTGCAACGAACCAAGGAGCTGCCGACGAGGGTATTTTCGTCCTTTCTCGG
CAGGATTCGTCACTGGCGATGGTTGTAAGTGTTCTCCTGCATTTCCTGCA
TCTGCTTCGTTTCTTTTGTTGCACATATTTTCCATCTTTCTCCGCCTTTC
ACCTCCGAAGGAAATCACTCTGCTGACACACAGAGAAAACACAAGAAGAG
ATGGTAAATAATGATGGGAGGAGGATGGTAAGGAATGGAATGCAATGGAA
TCCCTCACTCAGGTAAAACCAACGATTTCCGTGGACCTTTCTGGACGAAT
CTTCCCTGAGGTCATGAGCGCCCATTTGTAAATTACTTTATGGTGCAATA
AAAGTCGCTTGCCTGAATTGCCGACCGATTCCCAACGCAAAGTAACATCC
TTAAACACACAGGATGATC


Search Again