Insertion MI00329

Gene Information

Affected Gene(s)
SPARC          

PositionSPARC - 5' UTR exonSPARC - 5' UTR intron
PhaseNone

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R26870567+97D33R:26870567

FlyBase AnnotationTransposon
FBti0129292Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 30711

Flanking Sequence

MI00329
(GS926555)
GATCTCAACTACAGGGATTGCAAGTAAAGCATCTTTAAAACACCTTTTTC
TTCTCTTTATATTTAAACTATATATTTGGAACTAAAAGTGCCTTTATAAA
TAGAGTACATTATCAAGTCATTGCGATTGTCGAAACCCAAATTACATTGA
GATTAGCTTTGGCCCTGGCCCAACTTCCGTTTCAAGGATTGGTTTGCGAC
TGTACCGTGTGCGCTGCGTCGTTACTGTACTCCACTGGCGATC


Search Again