Insertion MI00231

Gene Information

Affected Gene(s)
CG13693     kis     

Positionkis - coding intronCG13693 - coding exon
Phasekis-RA:2, kis-RC:2, kis-RD:2, kis-RE:2, kis-RF:2

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L233527-21B52L:233527

FlyBase AnnotationTransposon
FBti0129248Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 30670

Flanking Sequence

MI00231
(GS926500)
GATCTTTCTCTGCAGCATTTTTTCTTCCTTTTCAAGGACGTGGGCCTCTT
CCTTTCGCTCGATATACTCGCTGACACTGGGGGCCTCATAGTCCTGGAGC
TGTGCTCTCAGCTCATCCAGAGTCACGTAGTCTTTGGTATTGTGCATTTG
AACTGCAGCCACCTCCTTTTCCAGTTTCTGAATGGCTCGCGTGACTTCAT
CCGTTCTATTCAGAACGGTACGCATTTCTGTTTCCAAGTTCATCATGGCC
TGTTTTTCCTCAGTCATGGCCAAGGAAGTTTTTCCTGTGACTCCTTTAAG
TCCCGCCATGTGTATGTTTTTTTCTTCCAGTTGATTCACCAGCTCGGTTC
TCTTTATAATAAGTTTTTCAAAATCTACAGCCGTCAGGATACCACTCAGG
TCTGATTTGGTTATCAAATCCGCCCGATGCTGCTGACATGTTTCTTGAAG
CGATACTATGGTTAACTTCATAGTTCCCAGTAAAGCGCGTGCATTTTTAA
ACCAATTTGAAGTGAACTTGCGCAATTTCCGTTCAATCTGTCGCTCAGTT
GCAGACTCCAAAAAGGCCACATCGTTCTCATCCCGTAAAAAGTGGAGCAT
AAAGTTGTTCTCCGTCTCAATGGTTTCCTCACTTCGAAAGCGGAGCTCTT
CTATCTTGGCTCTTAACTGTTTCACTTCGGTCATGGCTAAAAAGTGCATT
GTGAATGAATGAGTTTTGAAAACGAGATC


Search Again