Insertion MB11679

Gene Information

Affected Gene(s)
Tep3          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L7707174-28C12L:7707174

FlyBase AnnotationTransposon
FBti0127629Mi{ET1}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 29239

Flanking Sequence

MB11679
(GS597675)
CCGGATTGCTCTCAGCTTCCTTTTCGATAAAGTAATCCGTATTGGACATG
GTTATCACACCAGACTCCTTGCCAGGTGATCCCATTGGAGTGTTCACATC
GCTCAGTTCGTATGAACGCAGAGCATCCATCAGTCGTTTGTGGGTTAAAT
CATGACCACTCCTAAGGTCGTTCGCATTTTGCTCCACTAACATGAGGCCC
ACATATGAGTAGGGTTTGGTGCTTATGCCTATGTCAATATCTTGACCAGG
AGGTGCTCTAATGGGAGCGTCAACTTGTACCTATTAGTAATGAATGAGAA
TTTATAGAAATCGGAGATATACCTAATAACTCTTACCGCATTGAGTAGAT
TTTCTTCAAACTGTATGACCTGCTCATCGTAAACAAACTCCCCATCTATT
ACCGCATATACGAGCAGCTTCGCTCTCGGCATCATTGCAAATGATGCCAG
GAATTTGATTGTGTGGAAAGTCCCAGGGGCCACCTTGGAAAAGTTACCAA
ATCGCATAAAGCATACACTTCTTGTACAAAAAATATTTACTTACATCCAC
ATTGCGAGATAGTATAATATCGCCGCGACCGACAACTTGGTACATGAAAT
ATTTAATGGGCGCAAAGGAGCGTACGACCACAGAAATTTCCTGGTTTACA
GTGGGTCTTTAAATAGTGATACTATTATTAATAAATAGTTAAAATGTATT
TTCCATATCTCAACTGACCTATCATTCAACACTTTAGCAGTGATATAGTT
TTTGCTGTGCAAATGCTTACTCGGGATCTTTCCCACCTCACTGATCACGC
CCTGGTAGTCAACTATTATGGAATGAAATTCATCTCGATCTCCAATCGGA
ACAGTGAACTTCATCTTGATCTCTCCACTGGCATCCAGGCTATAGGCAGT
ACGGTTGTACATCTCACTGCTGCCATAGACATTCGTCAAATATGCGGTGA
TTTGGGGATTGAAGTCCCTCAATTGGCCGCCATCATTGCGGGCTATGCGA
GCCTGGAACAAAATTAATGTTCATAATTATCAACAGACATTTTCCTTGGC
CACCTACTGTAGCTTCAAAGGGCACTCCAGGAATATAGTAGCTGGGCACC
TTGACGGCCT


Search Again