Insertion MB10842

Gene Information

Affected Gene(s)
CG34437          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R28284705+98C33R:28284705

FlyBase AnnotationTransposon
FBti0127551Mi{ET1}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 29161

Flanking Sequence

MB10842-3'
(GS597597)
TATCATAGATATACCTACCGCTTTTGTACAAGTTTTATGGCTGAAATTAT
ATAGCGTATTTTTAAGCATCACCTTGGCACATTTTATGAGACAAGCGAGC
ACACACTTTTGGGCCAGCAGGCAATCTTATTGCCTTTAAGGCCAAAACTG
CTGCTGCCTTGTTGCTATTTTTGCTACTTATGTTGTTGTGGCTGCAATTG
CTTTGGGACCATTTAGCATTTTTCAAGTAACCACATGGGGCTAAGACCGA
CAGCGGATAGGGCACGAACCTTAATAGCCACAAAGAGGTGGCAAACGGAG
ATGCCGG


Search Again