Insertion MB06920

Gene Information

Affected Gene(s)
gry          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3L3200831+63B113L:3200831

FlyBase AnnotationTransposon
FBti0101717Mi{ET1}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 25338

Flanking Sequence

MB06920
(FI142740)
AGCACTGGACAAAAGTATGTCCTTTACAAATTTTCTTGTCCATTTAACTA
TTCTTCATTTGTTCGCAGGCACTATTTCCAAGCCTATGCCAATCTGGACG
AAATACGCATCAATGACGGCAATTGCCTGGAGATTAAGACTCTGGCAGGA
TTTTTGAACTATAAGATCTGTCGGCTTATGTTTAAGCTAAAGACTCCCAG
GGATGCCATTAACCAGTTCATCATCCATGTGGAGAAATACAAGTCTCGAG
TGGGTTTCAAGGATCTGGCCTTTGAGCATCATGCCTGGTTAAGCACGCAG
TAAGACCGAACTGTAGATCTCCTCTGGATATCCTAATTAATTAACCTTTT
ATTGCAGACATTCCGTATTCGCTGAGCTCTTTTGCGAGGCCATCAAGAAC
GGACTGCCCGCCCTACAGACTCAACATCCTGGAATCTATTACCATAAAGC
AGCAGAATTTGTGATGAAGCGACGGGATGCAGCCATGGAGGCCTATGCTG
CGATGCAAGCCTCCTCAGAAGCTACACCTACACCGATTCAGAATCCTCTG
TCCCTGTACACCGAGTTTTTCGGAATCCGTGCGGTAAAGACGGGCGATCT
GGTGGCCGAGCAACAAGCCAATATGCAAATATGTGATCAGGAGCGCAGCT
ACAACCATTCAGCGGCAATCATAGCCCTGCTCAGCCAGGCCATGGCCCAG
TTCAAAATTTACAAGTGCCTCAGGTTTCGAAAGAAACTAGCTATCGACAT
GGCAGAGGAGTACCTCAAGAGCGGGGATCATGCCAAGGCTTTGACGTAAG
ATTGTTTTTCATGTTCATATGTGCAAGAAAATTAATTGAACCTATTTCTT
TCCTAAGTTTGTATTCCCTAATGCTGCCCGATTATCGTCAAGAGAAATGG
ACTACGATATTCACTGATGTTTTGCTTAAAACACTGCGTTGTGCGCTGCT
CTCGGGATCTGTAGCCGACTACATTGCCTGCAGCGTTGAAGCATTGTCTC
TGCGCCATCAATCCGATCAGACCGAGCGAATTCTAATACTGGAGAACCTT
TGGCAGGTGTTTCAAGGCGTACCACCCATGCCAAAAACTCAGTTGACACC
CGAGGCGCAAGCGTTGTGGACTAGTGCGCTGGCCAACGTGAAATCGCCCA
TACAAATTGATTTAGATAAGGTCAACGATGTGTTGGAAATGTGTGCCACA
TTCGAGCGGGTTCAGTTGAGCAACGACGACTTGCTGCAGTTGCAACTGAT
AGTGCGGTAAGTTTAGTTGTCTTTCCTTCTTATATGCAGCTACTTAGTTG
TCCTTGTTTTTAGTGTGCTCACGGATATTCCTTTGAGGATACGCAGCTTC
CATGTCATTCTGGCCGACGCGGGAAATCC


Search Again