Insertion MB06703

Gene Information

Affected Gene(s)
Pkd2          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L12400974+33E32L:12400974

FlyBase AnnotationTransposon
FBti0101622Mi{ET1}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 25244

Flanking Sequence

MB06703-5'
(FI131186)
GCCCACGGGCGGTGTTATACCGCAAGCCCATCTGCAAACGGTCAAGATGT
ATTCCTTTTTTACGGATCGCAGTATGCTCATGACAGTTATCTACATTTTC
TGGTATATAATGGTTATCTACTACACCATCTATGAAATCACGGAAATTCG
CAAATCTGGAATTAAAATTTACTTCTGTTCGATGCTGAACATTCTCGACT
GCGCTATATTACTGGTAAAATCTTGCTCGATTATATTTTCCCAATATTCT
TAACCTTTAAAGTTATTACTTTTCAAGGGTTGTTACCTCGCTTTAGTGTA
CAACATTTGGCACAGTTTTAAAGTGATGTCCCTCACTGCCAGAGCCCATT
CAGATGTGACGTACCAAAGTCTGGATGTTCTATGTTTCTGGAATATTATT
TATGTCGATATGATGGCCATTCTGGCCTTTCTTGTGTGGATTAAAATATT
TAAATTCATCAGCTTCAACAAGACCCTGGTGCAGTTCACAACCACACTGA
AAAGGGTTTGTTCCTTAAAAAAAAAGGAATAGTACGTCATTTGTGACATA
TAAATCTTCTGCTTCTAGTGCTCGAAAGACTTGGCTGGCTTTAGTTTAAT
GTTTGGTATTGTCTTTCTGGCCTATGCCCAATTGGGACTACTTTTATTTG
GCACCAAGCACCCAGACTTCCGTAACTTCATCACCTCGATTTTGACCATG
ATTCGGATGATCCTTGGCGACTTTCAGTA


Search Again