Insertion MB01064

Gene Information

Affected Gene(s)
CG15712          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2R16485746+53C62R:16485746

FlyBase AnnotationTransposon
FBti0075804Mi{ET1}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 22981

Flanking Sequence

MB01064-5'
(ED562248)
CCGGAGTGGCACGAACTTGCTGCCAAGTGGCTATAAACTCATCGCTGCGA
ACAAACTCCACTGCCTGGCGAAACTTCGGGTCGAAGATATAGTATCTGGC
GGCAATAAAACCAATTCTGCGACGTGGAACCAAGGCTACGAAATCCTTGA
GATCCTCTCGCAAGCCGCCAAATGCTGTTGCCCAACAACTAATTGCTGAG
ATCAAAAGAATAACCGACACGGAGGTGGAGAAAGTCATAATGAGACTCTT
AGAGTTTTGGTAGAGGCCAAGCCTTTTATACCTTTGTGGGTACAATATTT
ACCACTGTCTTTGGCGGCGGGGGTGTGCCAGGTGCTAATTGTCAACTGTC
ACCAGTCTCATCAACTATTTGGACCGCACAAACTATTACACAGCCGAAAA
AAACGCCTAATATCGTCGAATCAGTTCCATTTATAAATATGTGTA


Search Again