Insertion KG09531

Gene Information

Affected Gene(s)
Blimp-1          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3L5634250-64E13L:5634250

FlyBase AnnotationTransposon
FBti0025035P{SUPor-P}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 15195

Flanking Sequence

KG09531-3'
(BZ665692)
GGCCACACTTTCTTCCTGGTTCGCTCTTTCTTTCTACCTGTATATCCCAC
CTGTGCGTCGGCGTTCTCTTTGCCGCCTCTCTTAAGCCTCTTATTAGTTT
TGTATGTTACCTGGGAAGCTGCCGCGGATGACTTGGCAGCTCCACCTCTT
CCTCAGCCTCATCCTCTTGTGCGTGGCAAGTGGCCAAGGCAGCAACAATT
TCAAACGAAGATGCAGCTCCAGCAGAAAGCAAAAGGCAGGAAGAACCGCC
CAAGGTAAGACCACGAGCGAGTCAATAACCCTGGCTCAAGCAAATAAAAA
AAGCTGGCCAAGAGTAA


Search Again