Insertion KG07569

Gene Information

Affected Gene(s)
Atg8a          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
X10767990+9E7X:10767990

FlyBase AnnotationTransposon
FBti0024654P{SUPor-P}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 14639

Flanking Sequence

KG07569-3'
(BH900934)
GTCTGGATATTTGCGACGGATCTTGTCGCCCTCGGCGCGACGCTTCTCGA
AGGCGTGCTCCTCCTTGTATTGGAACTTCATGATTGCAATGAAGAGGTAA
TTGGCTAAGAAACGCAGCTTCTATCACTTCGTTTGCTTTTGGGACTGTGC
CGAATATCGATGCGTTGCTGAGCTTGTGTTTTTCTCTTCTCTGTTTTCTC
GTACAAACGGTACGAAATACTTGTGTAGAGTGACCGTGCGCAGCAGTTGA
CAGAGCGCTTCGGTCTAAAAATCGATGACTTGCTGGTTTTATCGATAAGC
ACTCGCACTGTGGTGACTGCACTCGCTAACTGCTGTGGCTAGACTGACCG
TGTGTGACCAGTGAGCGCGCAGAGCCACCAACCCGAAACGCGCTAATAGT
GGTGGCATATTAGATAGACACCATTTGGTTCATGTATTCGCTAAATGTTA
TCGGATGCAACCATGTGGTTCATGTGCTCGCTAGCAGACGGCTGTCGATA
TGGTTGTTGTACGCGTTAAATGGTATACACACCTACGGTCACACTGCACA
TATAACAGTTTTTCGCCGCAATAGAAGAATCCCTAT


Search Again