Insertion KG02386

Gene Information

Affected Gene(s)
morgue     Elp3     

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L4444713-24F22L:4444713

FlyBase AnnotationTransposon
FBti0018807P{SUPor-P}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 12982

Flanking Sequence

KG02386
(BH256439)
GATTTCATCCGATTAAGGTTTACATCCTTTTTGGCTTCGTGCGCCTTCAG
CAGCTCCTGAATGATCTCCCCGATGACGAGCACCTGTCGTTCCTGGCGGC
TCAATCCCACGCCTGGAATAATTGGCGGGGTAAACGGACGTTTAAAGAAT
TACTTTCGTAGCGACGTTACCTACCCAACTTCTTTTTTGCCTTCATTTTG
CTGATGAATATCACATAAACTGCACGTGTGAAGTTAGCAGCACTTGTTTT
GATTCTGTTATCGACCGACCAATAGTCCGATAACCACAACACTGTTTGAC
AGGTTTTGAAGCTAACGCCACTTGGTAACACTTTTAGATGGTCTATCGCT
TGTCGATTATTTATTTGTTTTAGCACCAGTTTCTCGGGAGTTCTGTAAAA
TGACTAGCTGCGTGCCAGCGCAGCAGCAAAAGGACCAGGAGCAGTTGCTA
AAGGAACTGGCCAGCAGTGGCGACGAGATGGACGACCCGG


Search Again