Insertion KG00660

Gene Information

Affected Gene(s)
Dp          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2R13225045+49F112R:13225045

FlyBase AnnotationTransposon
FBti0021439P{SUPor-P}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 13398

Flanking Sequence

KG00660
(BH740681)
CCGGTATCATATTTGCTCTTACTTTTTCTTCTGCTTAGGCTTCTGCTTGA
TTTATTGTCTTTCCAGTTAAAAGTCGAATTGTGAGTTTTAATGGGAAACC
TATAATCGCACTATATTTAATTCAAATTATATTCGAACTTGGATTAATCC
GACTAATGACTGATCAACAATCTTGTCGAGTCACGAACTTTAGTATCGAA
CCATCTCTAATTGGTTAAGGGTCACGTGGTTGCCATCACTAATGTCCAGG
CGATCTGGTTTCGGGTTGTTTATGCTTCTGCATTTGTATCCTTGTCACAC
CGATTGAAACACACGCACACTCACCACCAGCACGTGAGTGTGGGTATACC
TTGTGTGTATGTGTGTATGCACCCCAATCTTAATGTGCCGCTCGCCTTTC
GTTGTTGTATTCCGACTCCAGTGCGCTTAACTCGCTCCATTCCATTCTCT
TCACTTCGCTGCGATGAATTCACCGTATATACGGCGAAAAAACGCATCGT
TGATAGTACCACACATACATTCAGTTACTCGCTAACACTCTGACACCCAT
GTGTGTGTCTGTGGAGTACATGCAGTTTTGTTATCAACGACGGCATTTCA
GTCGCGTGTTATGTGTATATCGGAAACTAAGGAACCTCCGCATCTTCCAA
TTTCCAATTCTGCAGGACAAATATCCAAAATGCTGAAGCCGG


Search Again