Insertion KG00101

Gene Information

Affected Gene(s)
Ten-m          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3L22407826+79E33L:22407826

FlyBase AnnotationTransposon
FBti0020866P{SUPor-P}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 13039

Flanking Sequence

KG00101-5'
(BH609987)
CGATGGGGAGCACAGGAACGCGACGGGAAAAACGGTGTTTTTGTATTGAC
GGTGTGTTTGTTTGCGCGACGATCGTAAAACTATGTCAGAATTCGTTAGA
CGCAGGTATCATTCGCTGCCTGATTCCCGACGATTTCCTATATTTTTCGA
CTGAAGCAACGCGCTGTTTTCGCTACTTTTCGTATATCCACATTTTCCGC
GACGACAATTCCGAC


Search Again