Insertion EY20423

Gene Information

Affected Gene(s)
Abi     twf     

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R14122201-88A93R:14122201

FlyBase AnnotationTransposon
FBti0075450P{EPgy2}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 23107

Flanking Sequence

EY20423
(EI200979)
CCGGAAAAGCATCTGTTGTGCAATCGCATAGTCAATAAAGTGAGTGCACG
CGAGATTCGTCCGATTAAACCGCTCCAGCGATCAACTGGAGCAGCTGGGC
GTCGACGTCGGCAGAGGCCAGCCCACGCCCCAAATGTTTACGGGCGTGAA
AAGTGCGGAAAAGCGAGGAATTTAATTGGGTTTTCGTTTCCCGTTTGCCC
GCAGCATCCACACCCATGTTGACCGAAACCCCCATGGCCAGCGAGAACAT
CATGGACGAACTAGCCTCTCTGATACGCACCGAGATCCCCGATGGCCGCC
AGAGTCTGCGGGACAGCTACACGAACCTGGAGCGGGTGGCCGACTACTGC
GAGGACACCTACTACCGCGCGGACAACAAGAAGGCGGCCCTGGAGGCCAC
CAAGAACTACACCACCCAGTCGCTGGCCAGCGTGGCCTACCAGATCAACA
CGCTCGCCTATAGCTACATGCAGCTCCTCGAGCTTCAGGCCCAGCAGCTC
GGCGAGATGGAGTCCCAGATGAACCACATCGCCCAGACGGTGCATATCCA
CAAGGAGAAGGTGGCCAGGAGGTAAGAACAATCAATTGCTGAATTGAAAC
AGCAGTAAACTAGAATAGGAAACGGGGATATGCATATTTTAAAACGACAA
ACAATACACAATGAAAATGTTTGTCTCTAAGTACGACTCATCGGTGATAA
AAGCTTCATAGAGAAGAAATGTACATTCATACATGCGTCGTCAGACGTGC
TGATAAGACTGAACGTCTCTTTCTTCATTCTTTTCCTATATAACTATTTA
GTTTTTTCAATTCACTTTATTTGTATTAATTATGTTTGATTATCTTCATT
GTCTTTGCTCAGAGAGATTGGCGTGCTTACAGC


Search Again