Insertion EY10708

Gene Information

Affected Gene(s)
jumu          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R10352083+86B13R:10352083

FlyBase AnnotationTransposon
FBti0040133P{EPgy2}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 20204

Flanking Sequence

EY10708-3'
(CL844348)
CAGCCGACAATAATTCCCACATCAAAAGCTTTTCTACCCACCTTCTCCAT
CTCTTTCGCACTGTTCTCTTTCGTCTCCGAGGTTTCGGCAACC
EY10708-5'
(CL844349)
CCGGTTCGCTGAGTTTTTCGTCTGGTGGTCTCTTCTTCGGCTTTTGCGTT
TTAAACTTTTTGAAGGCCAAGCGTTCACCTCGAATCTCTCGGTTTTCATC
TGTTTTAGTCACAGTCCAACCAAGTGGCTAATGATTTTGGGCCAGAAAGT
GGGGGTATGGCTTTGAAGTTTGGGCTAAACTAACCGCCTAAATTGTCAGT
CCGTCAGAGGAACTGACCTCCAGCAAAGTTTGCACATTTTCAATAGAAAA
TCAAACGAACGGACTTGGGAAAACACGTGCGCCTGTTACTTGCAACATGC
AAAACTCCACACACGCACGCACGCACAATCTACAAGTGTTGCGAATTCCC
AGTAAGCGTGTGCGTGTGCGAAGGGGAACAAAGAAAAGCAAACAAAATAA
ATCGTTTCATCTTGTACGCTTGTGTAAGTGCGAGAACAAAAGAAAACCAA
AAAGCAACAGTCGAC


Search Again