Insertion EY10058

Gene Information

Affected Gene(s)
Atg7     sec6     

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2R18625089-55E22R:18625089

FlyBase AnnotationTransposon
FBti0038986P{EPgy2}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 17635

Flanking Sequence

EY10058
(CL526180)
CCGGGCGATTCGGTGGCGATATTGTTCCACCTTCTCCAGTTGACCTGGTC
GCTGCAACATGTTCTGTATGTCCTTGAGCGCTGCCTGGCGAGCCTGCTCC
TCCAGCTGCTGTAAATCCATCTTCAATTTATTTGGATCACTTTCAGTCTC
TGTTTTGGTCAATCTTCGTCAGCAGTGGAAGTGCTGGTGTGACCATATAG
CAGTGCGGCTGACAATCTCACTTCCAAGAACTACAGTGTAACTTGACAAT
AAGCTATATTCTACTCTTAAAATTATTATAGTTTTATTGTGTCTTAAAAT
TTTTATTTTATTCTTCAAGCTTAAAAAATTATGAAGTTAAAGTATATCTT
TTAGTTTGCCAAAGCAACAGAGGATTCGACCTAAGTATGGAAAACTGTAC
TTATCGATAAGTTATCTTCTCATTGGTCTATCGCCATCGAGAGCTTTGTT
TGTTTATAATTTGCAGCCAAACGTTTGAACGTAAACAACGCCCTAAGCAA
AACATGAGCACGGAAAAAGAGATAATTTTGCAATTTGCTCCGTGGGAATC
TTTTGTGTCGCCCACTTTCTGGCACAAGCTAGCGGAGCTTAAGCTCGACC
ACGATCGCCTGTCCGACTCGAAACGCTCCATTACTGGACACTACACAAAT
CGTAATGCAAGTGGATGCCTTTTGGAAGTAGACTACACGGCCTACAACAG
GTGAGCTTGAAAACTACGAGTTTGATGAAACCAGCGCTTGACCACCCACA
TTCCAGAATGGCAAAGCCTCCAAAATTCAGCCATTCCGCTATAGGCACCA
TCTACAATAAGAACACAATCGAAGAGTTCAAGGCCCTGGACAAATTACAA
CTGCTGGCCGATGAGGGCAAGGAACTGCTGGCTGATATGTGCAGTGGTGG
CGCCTTGAGAGATCCCAGTCTATTGACCCGG


Search Again