Insertion EY09863

Gene Information

Affected Gene(s)
opa1-like          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2R14235422-50E42R:14235422

FlyBase AnnotationTransposon
FBti0039803P{EPgy2}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 20054

Flanking Sequence

EY09863
(CL610258)
AATCACTCAATGCAATATTTAGTGAAAATACATTAATGCCCATATGACAA
TTGACTAAAAAGGTTACTTGTTTTCTTTTTAACAATTTGTGACAAATTAA
AATGGAATGAAACTCACAACTCGCACAATTTAAAATTTGCAATTCAAATG
TTTGCGCCAAACTACAGTGTGTACACACCACAAATGTTGTAGAGTAGGTA
AAGGAAATAAAGCAATAAACATTTAACTGCTTAAAGCTTTTAAAATGTAG
TTAAGCAATGATGGATGTCACCAAGCAATTTTTTTTTAATTGTAAGAAAA
ATATACAATATACAAAAATATATTTTTGTATTTTACAAAATGATGCGTGT
GAAATACATTGTACCTAATGCAGGTACCCCAAACGAGTACAAGCCACCCT
TTTCAACTCTGGTCACACAGAGCACATCCCGTAAAGTTTTTCAGAGATGA
GTTTGCGGCAGGAAAATTGAATTATTCACGGAAATAAACAAAGTAAACTA
AGTGGAAACTGTAATCCTGACCAGCAATTATGTTGCGCATCTATCAAAAT
ACATACCGG


Search Again