Insertion EY09557

Gene Information

Affected Gene(s)
HBS1     CG12025     

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3L1865054+62B73L:1865054

FlyBase AnnotationTransposon
FBti0038931P{EPgy2}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 17580

Flanking Sequence

EY09557
(CL526122)
CCGGCTTGGCAGACTTGTTGGTCTCTTCGTTGAGGATCTCGTCCAGGATC
TTCTGCATGTCGTAGTCGAATTTCATGGATGTCTCCACGATGCGGCGCTC
GGAGACGGCATCGCCCACCACGCTGCGCACCTCGTCTACGCAGGAGCTCA
GCTTTGCCTGCTCGATCTCGTCCAGTTGCGGCATTTGGAAGCTCTCGGAG
TCGCGGCGAGCCTTCGCGAAGGCGGCGTCCTCGTCCTCATCCTCGTCGGC
CTCCTCCTCTTGGATGTCCTTGTTCTTGCTGATGAACGCCGAGATGCTCT
GCTGGCCACGAGCTCGATCGTAGAGCCATTGCTGGGCATCCGTGGGCGAG
ATGCAGTGCTCGTCCTCCACGGAGTGCCCGTAGATGTCGTCGTAGCCGTC
GTACTCATCATTGTAGTCCATGGTGCGCACTATCCTGTGCCGCGACATCT
TGGAGGACTCTGTATTTCACAATTTACGGAGCAGGGTCAGAATTTCATCA
AAAATAATAAAGGTGCGTGCAGGTGTGGCTGCCTTTTCAGAGGTTTGGTA
TTTTGCGGCACTTTGACCAGGAGTTTTTAGTACAATAGTACGGTTAGAAG
GTATTGCCACTAGCGGAGAGGCGACTGTTCTGATTTGCTTCATGTATCAA
TCAATTGACATAAGAATCTAATAATTTGTTATTTTTAAAATCTGCACATT
TTTCAAATATGTTATAAGGTCGAAAGAAGGAACAACATTGGTGCAAGTGT
GAAACCGTTTAAGCATAATTGATGCGGCCTTGTGTGAACAATGATGTGTG
CTTAAATATACCAAGCAGGCTGGCAGCCACCCCCACACAGCATTTAACCA
CCCCCGAGGAACGGTCACACTGCTGCGAGTCTGAATATTTTTTGCTTTGT
GTCGCGTTTTAATGTGAAAAGAAAAACACTTTTTCCACGGTTACGGGCGC
AGAAATCAGTGCAAAACATTGCGAATACGGAGTGCCCGAAAATGCAGGCG
GGGCAGCACTAAGTCGGAGCCGCATCTCCCCCGATTTCCGCCGTGCTGGC
AGCCAACGTTGGCAGCCCGAATCCGAATCTCCAGCGCACTCGTTTATTAT
TAAACAACGGGCAACGGAAACAGGGAAAGAAAAACGCAGAGAATCCAAGC
CAGAAAATATGTACAACAACGGGGCC


Search Again