Insertion EY05137

Gene Information

Affected Gene(s)
ewg          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
X276336-1A1X:276336

FlyBase AnnotationTransposon
FBti0027358P{EPgy2}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 15784

Flanking Sequence

EY05137-5'
(CC060377)
TGGTTTAAAGTAAGGGAGCTTTAATGGAGACACAGTAGTGCACGTTTAAC
CGAAGTTATAAGAACATTCAAGTAATAACATTCATAACACATAAATAAAG
TGGTATTTTTAATAAAGCCCCTGGACAGAGAAAGACGGCGAGAATTCCAT
ATACCCATTTCAAGCAGCAATATTGACGCATGGGCGCCGT


Search Again