Insertion EY04469

Gene Information

Affected Gene(s)
CG7556     CG7453     

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
X19179739+18A5X:19179739

FlyBase AnnotationTransposon
FBti0027322P{EPgy2}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 15748

Flanking Sequence

EY04469
(CC060340)
CCGGTCGCATCATCATCGTGGTCCGAGTTCCGAATCCAGGTCAGGTCCAA
ATCGGAGTAAAATCCAAATTTAATGCGCCAGACCCACGCACGCACCACAA
ATACAC


Search Again