Insertion EY02632

Gene Information

Affected Gene(s)
Keap1          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R17078122-89E123R:17078122

FlyBase AnnotationTransposon
FBti0025273P{EPgy2}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 15427

Flanking Sequence

EY02632-3'
(BZ748908)
GGCTGGGCAGACGCAGACCACGGCAGTCAGTTGACGGGCTCTCTCCACGG
CACACGCATGATCGCCGG


Search Again