Insertion EY01148

Gene Information

Affected Gene(s)
Hsp70Ab          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R11958394+87A33R:11958394

FlyBase AnnotationTransposon
FBti0025170P{EPgy2}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 15327

Flanking Sequence

EY01148-5'
(BZ748801)
CCGGATCCTTAAATTGTATCCTATATTAAAACAGAAGAAAGTCCTTTAAT
AATCGAGTTCCTCAACTCAATGGCCAAACTAATATTTAATGCATATGCCG
AATGGGCATTTATTGGTTTATTAGATTGGCTGCGCCGAAAAATAAGCCAT
GGTCGGTACGATAAGCATAACCAAGCTCTGCGATTATCTCTAACATAATT
AATTTAAGCAGCCGTATTTATAAAGAAATTTCCAAAATAAAGCGAATATT
CTAGAATCCCAAAACAAACTGGTTGTTGCGGTAGGTCATTTGTTTGGCAG
AAAGAAAACTCGAGAAATTTCTCTGGCCGTTATTCTCTATTCGTTTTGTG
ACTCTCCCT


Search Again