Insertion BG01694

Gene Information

Affected Gene(s)
Rpn11          

Position
Phase

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2L5059760+25C32L:5059760

FlyBase AnnotationTransposon
FBti0018544P{GT1}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 12848

Flanking Sequence

BG01694-5'
(BH146125)
GCGCTGACTAAGCCAAGTGCTCACCTCTGGGATTTGTAGACACTCTGTGA
TTGGGGGCAAGTATCAACTATTTCCTACTGTTTTACGTGTAATTTACGTT
CCTCGTCGAAAGCAGCAACAAAAAACACAAAGCCGTCCCGTTTGATTTTG
CAGAATTGCAAG


Search Again