CR99921

CRIMIC CR99921

Gene unc-119

CG1659

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 no rxn no rxnOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CTGTGAGATGAGGCTTCTATTGG

Amplicon 5' Amplicon 3'


Search Again