CR99918

CRIMIC CR99918

Gene Vps35

CG5625

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78999

Images

Construct Sequences

sgRNA sequence

Amplicon 5' Amplicon 3'
CCCTCAAGGCGTGGTTTAGTAAGTGGCTGCACTGCCACTGTGGGGGCTTTTGGAAGCAGGTTCACTAGTAAATCTATGTGAGCAATGACCTTAGTTATTAAGTATGATTTAAGCTTCAAATAAAAGTACATGATTGCCAGCAATTTTAGTGAAATCAAGAAATTTAATATACTAAATATATTTCTTCTTTGCACGACGTGCTCGTTCAAAAAACTTAAGCCACAGAGAAGTCACCACCATACTTCACTATTTCAAAACTAAATTTATTTGAATAAAATATATTTTTTAACTCTATCTATGAATTGTGGTTGGTGTATTTGCTAACGGTTTGATATTAACAACAACAACATATCGAAGAACTTGCATCACTAGCATGTCAATCGATATCAGGACGTCCAATGTGTCTGTCGGCTGTCGGCAATCGATATCTCCTCTGCAAATAGATATTTTCAGAATAATTGGCTTATTTCACTTCGCCCTAACGCTGCAGTAATGGTAAGTGCATCGAGGTGCAACCTGTAGTCGCCAGAAGTCGAAATTCCTAGAGAACCGAGTGCCCCAGGTCCAGGCTTAACCGAGTGCTGAGTGCCCACCCTGTCGACGTCAAAAGAGGGCTGCCTGTGGTGAGAAGCAACGCCCCCCCGGTCCAAATCCCACGTCCATGTATCCCTGGAGCTCCTCCTCGTACGGCGGCCAGATTCCCAGTGCCGCCAACGTCCGGGTAAATACTCCGCCAATCCCAGATTACGAATCTTGGATATGTGTAATCGTTAATCCACTTATCTTCAATTTGGTCAATCCTTCGTCTCAACTTCCGGA CGGGAATGAGTAAAGTGGGCTTATCTCGAGTTTATTTTATTTTTATATGTATATCTTAGCCAATAATATTGCTTACCATCTGTCCTTTCAGACCATGCCGAATGGTTTGGATGACCAGGAGAAGCTGCTCGCTGAAGCCATTGGACTAGCGAGGAAGCAGGCCTTTCAAATGAACCACTTTCTGGATAAGGAGCGTATGCTGGACTCGCTCAAGTGCGCCAGCACCATGCTGGGCGAGCTGCGGACCTCCGTCCTTTCCCCCAAAAGTTACTACGAGCTGTGTGAGTAAAACCAAAGCGTCTTTATACAACTTCAGATCTAATCGATTTAAATGAACCGCAGACATGGCCGTCACCAACGAACTGTGCCACCTGGAGCTGTACCTCAGCGAGAAAATCGACAAGAAAACGGATTTGTACGAGCTCGTTCAGTACTCGCATACTATTGTGCCGCGGTTGTACCTCCTCATAACAGTGGGCATTGTGTATATCAAGAATGACCCTACGCTGAAGCGCAGCATTCTAAAGGACCTGGTCGAGATGTGCCGCGGTGTCCAGCATCCGTTGCGAGGCCTCTTTCTGCGCAACTACCTGCTGCAGTGCACCCGGAACATCCTGCCCGATGTGATGGTTGAGGAGAACGAGCACGAGGGCAATGTCTATGATGCCATCGACTTCGTGCTGACCAACTTTGCCGAGATGAACAAGCTGTGGGTCCGCATGCAGCACCAGGGACACTCCAGCGAAAAGACGCGTCGCGAGAAGGAGCGTGAGGAACTAAAGATCCTGGTAGGCACTAATCTGGTGCGGTTGTCCCAGCTGGAGTCGGCCACTCTGGAAATCTACCAGCGACTCATTCTACCCGGCATCCTGGAGCAGGTGGTCAGCTGTCGCGATGCAATTGCACAGGAGTACCTAATGGAGTGCATCATCCAGGTGTTCCC


Search Again