CR99911

CRIMIC CR99911

Gene Lamp1

CG3305

Information

Donor Location Cytology FBti Stock number
pM142L:21573801..2157389639E2Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK TCTTTGATATGACTTTTGCAATAAAC CAACATGGGTCAACAAACT

Images

Construct Design Sequences

sgRNA sequence TCGCTTACGTTCGTTAGCCCCGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
AACGTCAAAGAACCTCTAGGGTGAAGGGGATATTTTGTCCCATTTACAATGCATGAGCATACGTGTGCACACATACAGTTGTTAGCTGTAGCGCTCTTCGCTCTCTCGCTCTCTAACAAAAATTCGAGAGAGCCTGGAGCCACCTCTAGAGCCACGGCGAAAAAATCGTGTGCCAAAAAATCGTATGGCGTTACGCATCTTGTTATTATAGTGTCTTTGGTAATACCTAACATTTTTTCATTAAGTCAATGAACTCAAAATATGGAAATTAATTTATAAATATTTCCACTGTGTTATAAACCCTGTGTGTTATAAACCTGTGTTATATAAACCCGTGATAAAATTATAACATGTTATACATATAATTCTTTCGATTGATCAGAAATTAAATGTTTGATAAGAAAATGTACTAATTGTATTATATTATGGAATTAAGAATATATTTTTTGGTATATTATTATTATAAGTTTCATTAAATATCGATAGACATCTTGCTGTAGTGGACATGTACTATTATTACGGTTCCATATGGGCTAATTTTAGTTCTTTTAGAAATTCGGTCACACTATTGATGAAGAAGGTCAAAATAAAAACTAGCTCAGTCGAGACAAAAACGTATGTGTCAGTGTAGTAGATTAACGTATAGAAAAACTGCAACACAACTTAAGTGAGATTGCCATTCAATATGTTCGCCAACAAATTGTTGACCTGCTCGGCATTACTAATAATGTTATTTTTACTAAGCAGTACAGGTTAGTGCCAAGCCAATTAAACCCTTTTTAAAACAGCAATGAAATGCGTCGCATTGGAGGCCTTTGTTCAATGTGATAATACATCGCAGTTCTTTTTATATGTATATGTATGTCGTTTGTTCATCGCACATAATTTATTTTTCCGGTGCCGTTCACGTCGCCATATGCGTTAGTGTCTTATCGGCGTAATAAGGTGTAAACGGTTGAATTGCGAGTTTTGCCTTCGTAGATCAAGGGTTT CCCCTTTCGCTTATTTGTTCTGGCAATTTACAGTTTTGTATGCAGATAAAGTCATCCGCCACCGTATGCATCCATATTTATTTTATGCACTTAAAATATTTATATGCATGGGTGTATAAATCGGCATATCATATTAAATTTGTATCCGCCATATAGCATACTTTAGTTTTTGGTTACTATCTGTCAATTCATATAACAAGATTTTGGGTCATTTGTTCAATACCAATGTTAGACATTTGTGCACATAGTATATACAAAATAATATATGACATAAAAAAAACAATCTGTGATAAAATAACAACAAGAGATAACGCTATAGTCGGTTCTCTGACTATCAGACTATGATAAGCGGATAAGACAACAAAGACTTGGAGCTAGACTGGGCATATGTATGTACCTACATATTTGGGGAGACATATTAAAATAAACAATTTAAAACATTTTTTTTTATAGCATGCGTGATAAAATGTTTCGGCATAGCAACAGAAGGATAAATGATTAAATCAGAAAATATTTTTTATTTTTTAATTTGTAGTGTGTTCCTACTAATCTTATCTTGTTAAATAGTTCTATAACCAGACCGAATTTAAAATTCGATTTCGACCTTATACATTTGGTTTGTATAAATATTTGACAATATGTTACGGTACGGCCATTTTCATAGGATCTCTACAAATCACTGAAAACGGAAATAAATTGTCCATCAAGTCCAAACTCACTAATATAAATAACAAAGGGTAATTTTTTGATAAGAGAACAAAGGAAATACAATTAGAGCTAACCATATGTACATTTGAATCTCTAATAAATAATTTTTTTTTCACGTCAATTTAAAGAAAATTCCGATTTAATAAAGAAAAGCTTTAATATTTTTAAAAATTCTTCTTTTAGTGTTCTCTCAAAAGCTTATTGGCTTGCCGAGAGTCGGTAAAAATGTTAGTGATTTGTTTCTGGAACAAGCAAACCCACTGACCAGCAGCTCCTCAACAATCTCAACGTCTTCGACAACAACTGAGAA
 

Search Again