CR99910

CRIMIC CR99910

Gene jp

CG4405

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence

Amplicon 5' Amplicon 3'
TTTCCGAAATGTGATGGCTAGTAGCAAACGACGCGTCGGCCCCAACGGATTACCAATTGAATTTGTAGAGAAAACGCTAGCTGACGTCGAGTGGCAATATAATTATATATATATATATATATATATTCATTCAGAACAAAAAAAAAAAACACATAGGAATTCTGAAAGCAATTTTGTGCGAAGAGTCAGCGACAATATCCGTTGTTGTTTTGGCCCCGTGCCGTCGTGGCGGGTTGTGGCACTATTTTTGGCTTCCCAACGGACGCAGTGACTCTACGTGTCCGTATATCGACGCTCGGTGTTCAGTAAAGACGGAACGCCATGTCCAACTCGTTTACAAGTTGGAACCGTCTGTAGAAGAAAGATTACACAAATTGTCCAACGTTATGCAAGCAGCTAATTAGCTGTAGCTTCAGTCATAGAACTTTTTCGCCTGAAAGTAGAAAATCAGCGAGCATGGACTGGTATCCGGAGGAGGATGAGGAGGACCTCATGTTCTCGCCGGCTTTGTTGGCCAGAAGAGCCAGCGAAAGCTGGATCGTTGAGCCCCCCGTCGAGGTGGAGAATCCCCCCGCCCATTAACTTGCCATGCTGAACTAATTCCTGGAATACTTCTATCCCACATTTTGCAGTCGGTGCCCATCAATGTGACGCTGCAGCGAAAGAAGTCCATGCCCGATTTCCAGGAACTGCCGCGAGCCACGGAGGCCATGAGCCGGGAGGAGGTGTCCGCCTTGGGTTCCGCCCGACGGGAGGCAGTGCGTCGCCAGATCGAGGTCAACGAGCGGCTCAAGGCAAATCCCTTGCTGTATTTGGTCAGTCCACAGGTTAAGGTGAGTGACAGAAGGCCGACACGGATACGAGTGTAGTATAGTTTTGGTTGTTTGGCCAAATGCCTTTGATGTTTCTGTAATTGAAATGGATTTACAATTGGTGCACTTAACTTGTACCA TTGACGCCATAGAAAACTCTTTGCCAATTAAAGAGGTTCCTAATAATTATAAATGCAATTAGTGTGAAATATTTTATTACACGATGCAAAAACAGCTAATATATTTCATGAATTAAAAGCATTAAGTTTATTGTGTTGAAAATAAATATGTTTTAAATCTATTTATATTCAATTGAAAACAAAAGAGGATTAAAGCAAACTTATTCTCTTATAATTCAAATTAAATTTAGGATGTCAATTTAATAGTTATTATCACTATAAATTCTAATCGAATTTCGACTTAATACGGAAAACATTTTTTATTAAAATTGAAATTGAATTTTAAATTACTATTTAAACTATTAACACCATATTTTGAATATAATTCAATGTTGTTTATCCATCCAGGACTGGTTTGTGCGCCAGCAGCTGATGCTGCTCGTCCTGATTTTCAACGTGGCGTTGGCGCTTCTATTTGTCTACATGCTCACCTAGCGCCGGAGGATGCACAGGACGACGCGGAACAGGGACGGATTCGGATTGGGTGACTCGGGGCAGCGACTGGCTTTGAGCCACAGTGCGTTTGGCAGCCACCGATAGTTCGGGATTCGCCGTTGGACCTGGGAATTTTATGGTCATATTGGATGGCCCACAACCAGTGTCGTGGTGAGGGCTAATAAGTTTTTAGCATTTGCAGTGATGAGTTGATATAAAGCAGAACTTATATAAGTATCTAAAGTACCATAAATGTATATCATATGTTTAACATGAGGAAACACGCTAGAGATGGGAAAAAGAAATCGAATTACAAGTCTAGACTGCAGCCAAATAATGGATAATTAAATTAACTAAATAGCGCAGAACTGCAATGCACAAATCGTAGCAAAACTAAATACATACTTAAATCGCGTGGCTGTGCAGCCAATCATTTAA


Search Again