CR99909

CRIMIC CR99909

Gene Got1

CG8430

Information

Donor Location Cytology FBti Stock number
pM142R:16139551..1613960752E7FBti019948278998

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
ATTGTCGCTCCGTTTGGACTTGTTTCCCAAGCTATCCACGATGTCCATCTACGCCGACGTTCCAAAAGGACCCGCCATCGAGGTCTTCGCCCTGACGCAGGCCTTCAAGGACGACAGCAATCCCAACAAGGTCAATTTGTCGGTGGGCGGTAAGTTCTAAAGTTCTATTTTCTCACCCCACCCCCCTCCTCTAACAGAATGAAGTGCATACCTATGTATGTGCATATGTTTATAAAAAGTATATGTGTATTACTTAGCCGGCTGTATTTGTGTGCGGCTCAATTTGCTATCATTTGCTAGTTGGCTTGCCCTTGCAATTCGCCACCCCCCGCACCGCTGGAACGCCCGTTTCCGTTTGCCACCCAACAGGCCACTCTGCTGGAGGTCATTTGGATGTCAATGTCGCAATGTATGAATTGCACAGATTTTTCCATCCTTCTTGCTTTCCAATTAGTTGGCTTATAACCAATTGTGGATTTTGTGTGTGTGTAAACAATTTCAAATACTCTATATGGTTAAATATTACAACCTATTTCTTAATTACTTAGTTACATATTTTGCTTATTCCATTTTGTTTCAGCTTCTCAATAATATTTAAACTCAATGTTTGCTTAAATTAGCAGCTCAAAACGTAGTATTTTAAAGCTCCGATTGTAAATATCAATCTAATTTTTTTTAGTAGTGAATTTCTTTTGCGACTTTCTTTGTTCTATATTTTCCTCTGACGTCAGCTAACACCGTATTTATTTATTGCCTATGTATGTTTTTGTGTGGCGGATGATGATAAGCCACTTGTT AACAACAATATTGCCGCCGGGTCGTTCAAGAGCAATTTTGCTTCACCTTTTCTATATTTATGAATGTTATTGCATAATTTAAATAACAATTCCCACCAGCAGAGTCGCCGATTATTGTATTTTTGTTTTGCTCGCAAAGCCAAGAGTCATTAACCCTTGCTCGTGTAAATGATTATGCCAATTTATTCGACGTATTTTGGTTTTAATAGCATTAGAATTAATAAATATGTATATTCAATGCCAAAATCAGCTGATTTACAAAAGGTATCTTTAAACTAAACTTATATCGAATCATGGTATTTTATTACCATATTAACTCAAGCAAATGGATGTTTTAATGAGCTTAATTATTCATTCTTCTCATTTCCGTCAATTTATTGTCGTTATGGCTTGTTTATCGCGCCTTCGCTTTTATTTACAATGCTGCAAAAGTATAAACATTACCAGACCAATTCATTCAATTGGTTTCGTATAACACGACGCCAGTGCTTTTCAGTTGCTCCAATAAATAAATAAATTGGCCTAGAAACAACGCATGAAAACAATATCAAATGGCCTATAGCAATGAGGATTGATTAGGCTTGTTAAGAGCATTCAGATAAGACTTGAATATTGTACGGATTTTAGCACTTTGACCCATGTATTTCCCTAAACACTTGAGCAATCAGTGGACTTCGAATAAATTGGTTTACTCATTTGATCTTTGGTTTCGTTCATTCACAGCTTACAGGACAGATGCTGGAGTTCCTTGGGTTTTGCCTGTGGTGCGCAAGACGGAAATCAGCATTGCCAGCGATGAGCAGGTTAACCACGAGTATTTGCCAGTGACTGGTGAGTAAATGCAATGCATTTCATCAAAGTAATTTAATTAACCCAATGATTCTGTTTTGCAGGACTCGAAACATTCACCAATGCGGCCACTGAATTGGTTCTGGGTGCCGATTCCCCAGCCATCAAGGAGAATCGCGTAAGTTGGGGCTCAACCTAAAAATATGTACTCTTTTATTAGACTGCAATTTTCTTGTAGGCCTTTGGAGTGCAG
 

Search Again