CR99909

CRIMIC CR99909

Gene Got1

CG8430

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78998

Images

Construct Sequences

sgRNA sequence

Amplicon 5' Amplicon 3'
ATTGTCGCTCCGTTTGGACTTGTTTCCCAAGCTATCCACGATGTCCATCTACGCCGACGTTCCAAAAGGACCCGCCATCGAGGTCTTCGCCCTGACGCAGGCCTTCAAGGACGACAGCAATCCCAACAAGGTCAATTTGTCGGTGGGCGGTAAGTTCTAAAGTTCTATTTTCTCACCCCACCCCCCTCCTCTAACAGAATGAAGTGCATACCTATGTATGTGCATATGTTTATAAAAAGTATATGTGTATTACTTAGCCGGCTGTATTTGTGTGCGGCTCAATTTGCTATCATTTGCTAGTTGGCTTGCCCTTGCAATTCGCCACCCCCCGCACCGCTGGAACGCCCGTTTCCGTTTGCCACCCAACAGGCCACTCTGCTGGAGGTCATTTGGATGTCAATGTCGCAATGTATGAATTGCACAGATTTTTCCATCCTTCTTGCTTTCCAATTAGTTGGCTTATAACCAATTGTGGATTTTGTGTGTGTGTAAACAATTTCAAATACTCTATATGGTTAAATATTACAACCTATTTCTTAATTACTTAGTTACATATTTTGCTTATTCCATTTTGTTTCAGCTTCTCAATAATATTTAAACTCAATGTTTGCTTAAATTAGCAGCTCAAAACGTAGTATTTTAAAGCTCCGATTGTAAATATCAATCTAATTTTTTTTAGTAGTGAATTTCTTTTGCGACTTTCTTTGTTCTATATTTTCCTCTGACGTCAGCTAACACCGTATTTATTTATTGCCTATGTATGTTTTTGTGTGGCGGATGATGATAAGCCACTTGTT AACAACAATATTGCCGCCGGGTCGTTCAAGAGCAATTTTGCTTCACCTTTTCTATATTTATGAATGTTATTGCATAATTTAAATAACAATTCCCACCAGCAGAGTCGCCGATTATTGTATTTTTGTTTTGCTCGCAAAGCCAAGAGTCATTAACCCTTGCTCGTGTAAATGATTATGCCAATTTATTCGACGTATTTTGGTTTTAATAGCATTAGAATTAATAAATATGTATATTCAATGCCAAAATCAGCTGATTTACAAAAGGTATCTTTAAACTAAACTTATATCGAATCATGGTATTTTATTACCATATTAACTCAAGCAAATGGATGTTTTAATGAGCTTAATTATTCATTCTTCTCATTTCCGTCAATTTATTGTCGTTATGGCTTGTTTATCGCGCCTTCGCTTTTATTTACAATGCTGCAAAAGTATAAACATTACCAGACCAATTCATTCAATTGGTTTCGTATAACACGACGCCAGTGCTTTTCAGTTGCTCCAATAAATAAATAAATTGGCCTAGAAACAACGCATGAAAACAATATCAAATGGCCTATAGCAATGAGGATTGATTAGGCTTGTTAAGAGCATTCAGATAAGACTTGAATATTGTACGGATTTTAGCACTTTGACCCATGTATTTCCCTAAACACTTGAGCAATCAGTGGACTTCGAATAAATTGGTTTACTCATTTGATCTTTGGTTTCGTTCATTCACAGCTTACAGGACAGATGCTGGAGTTCCTTGGGTTTTGCCTGTGGTGCGCAAGACGGAAATCAGCATTGCCAGCGATGAGCAGGTTAACCACGAGTATTTGCCAGTGACTGGTGAGTAAATGCAATGCATTTCATCAAAGTAATTTAATTAACCCAATGATTCTGTTTTGCAGGACTCGAAACATTCACCAATGCGGCCACTGAATTGGTTCTGGGTGCCGATTCCCCAGCCATCAAGGAGAATCGCGTAAGTTGGGGCTCAACCTAAAAATATGTACTCTTTTATTAGACTGCAATTTTCTTGTAGGCCTTTGGAGTGCAG


Search Again