CR99907

CRIMIC CR99907

Gene CG8888

CG8888

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence

Amplicon 5' Amplicon 3'
TCCAAGTGGGTCAACGTACGTGCGAGCCACTAGAAATTGAAAGATGCAAAATGCTAGATGCAAAATGCTAGATGTAAAATTTAAGTGTTCCGCCAGAGACTTGTCAAAATTCTACCGCCTGCCTGGGATTTTAAGTGCAACTTAAATGGATGTAGTAATGTTATAATGACTACATTATAATCAGATTTGCACAATAAAAGTCTTGACATTGAGGCAAACGATTATGAACATTCCACAAGGGATTGGATTTTTTCCAAACGAAATACACATCAAATACATTTTCATCATGAAAATACAGTGCGAGTATTTTTGCAATGCCAGAACTTTCCATTCCATTTGATTCGGCCGCATCATCTAAAAATAAATATCCATATCTTTATTAATAATAAAAATAAGCTTGGAGACATATACCGATTTCTTGGCAGCTGAGCGACCCCATTAAGTACATAAATCGTACATAAATACACATAAATATAGATATATCTGAACCGGCAGCAAGTGCATATATGTATATGTACATACATAGATCGGATCGAAATTGTCGCCCATATGTAGGCCACTTACAGAATGGCGGCATTAGTCACATATAATACTCACGTATCTGTGGCAAACTAAGTCCCAAAATTGGTGGCAAGGTCGCCGGATGACGAAAGCAATCCGAAATGACATGGTCGATTTCCTTTTAATATTCCAGACAGCACTAGGAGGTATAAATAGATCCGGCGATTTTACAAATCCGGCGAAGGAAAAATAGTCGAAGCAACCGAAATGGAATTGCTTTATTTTCAGGCCGAATAAATCAATTGGCTTCTGTATTTATGCAGATGCCACCATTTGATTATTTCGCACTGTCGTTGATTTATGGCCAATGGCCAAAAGGGGCTGCCAAGGGTGCCC ACACACACAACCGACCGATTTTCCAGTGGCTTTCCCACACTTTTTCGAGAGTATTGTGCACGTCATGTGTAATTGCTATACGTCAATGTCAATGTGTGGGTTAGCGTCTGATAAATGCAAGCATATGTATATGTTGGTGTAAGTGCTTGTGGTCGTTTCCGGATCCTGTGGCTGCAATTGGTTAGCTTTAATGAAATGCCCGATGATATATTGTTGGGCAAATATGTGCTCGACCATTTCATCAGCCATTGAATTCGAACATTGAGCAGAAGTATTATCGATTTCAACGAGCACCAAATCGGAAGTCCTGAGTCAATAAATTGTATGGATTGCAAATGGCAAAAGATTTTCATCAGCTTTTCTCGATTGGCGGGCAACAGATTGCCGCTCAGAGTTTTCCAGCGAATTCCCGACTAATCCAAATAAAACTTCACAGCTTCCCCGACAATTCCGGTAAACTCAGGACACCTGTCAAGCAGAAGAAAGCACTCAATGCAATTCTGGGAATATTTCCAATCGGATATCTTTGATTTTCCGCTATGGAAATAAAAACAATGAGTGCGTGCAATAATTTGCATATTCACCTTATTTATTGATCAAAACACAAACAAACGAGAGCTGCCACAATTGTTTAAATATTTCCCAAACAAACAAGGCGCAGCTATTTTGTCTGGCTATTTATAGAGCTGAAAACTGAAATGCTAAATGCGCTGCAATGAAATGAATAATTAAATTGGCATATATACCACCGTGATTAATATCTATCTATGTATCTATATATCTTTTATCCTTTAGCGCCGTGCCTCGCGACGCGCCTCCTTGCGACGAGGATCCATATCGGCACTGCCGCAGAAGTCGCACGAGATTCCCTGGGACATATT


Search Again